fasta format

fasta or fasta.gz (compressed version) is a very generic text format that is used to store sequence data. A fasta file has at least one record, each record consists of a minimum of two lines.
  1. ID, starts with >
  2. Sequence, typically wrapped to multiple lines at a fixed maximum line witdh.
>gi|30212|emb|X56692.1| H.sapiens mRNA for C-reactive protein
GGACTTCTAGCCCCTGAACTTTCAGCCGAATACATCTTTTCCAAAGGAGTGAATTCAGGCCCTTGT
CTGGCAGCAGGACGTGACC

References:
  1. Galaxy Wiki

create bowtie2 index for reference genome

Usage: bowtie2-build [options]*  
bowtie2-build does not support reading from standard in, so the input file is extracted first.
product: Intel(R) Xeon(R) CPU E5-2620 v3 @ 2.40GHz