fastq format

fastq
fastq or fastq.gz (compressed version) is used to store NGS data. A fastq file has at least one record, each record consists of four lines.
  1. ID, starts with @
  2. sequence
  3. End of sequence, starts with +
  4. Sequencing quality information. One ASCII encoded quality score per base.
A record’s sequence is called read.
@ERR315326.7031172/1
TGGCACCACACCCCTCTAAGACGCAGCAAT
+
BBBFFFFFFFFFFIIIIIIIIIIIIIIIII
Quality scores can be represented using three different encodings which use a different range of ASCII characters:
NameASCII character range
Sanger, Illumina >= v1.833-126
Solexa, Illumina < v1.359-126
Illumina v1.3 - v1.764-126

References:
  1. Wikipedia
  2. Bioinformatics Data Skills
  3. Galaxy Wiki
Share itShare on FacebookShare on Google+Tweet about this on TwitterShare on LinkedIn

1 thought on “fastq format”

Leave a Reply

Your email address will not be published. Required fields are marked *