fasta format

fasta
fasta or fasta.gz (compressed version) is a very generic text format that is used to store sequence data. A fasta file has at least one record, each record consists of a minimum of two lines.
  1. ID, starts with >
  2. Sequence, typically wrapped to multiple lines at a fixed maximum line witdh.
>gi|30212|emb|X56692.1| H.sapiens mRNA for C-reactive protein
GGACTTCTAGCCCCTGAACTTTCAGCCGAATACATCTTTTCCAAAGGAGTGAATTCAGGCCCTTGT
CTGGCAGCAGGACGTGACC

References:
  1. Galaxy Wiki

Share itShare on FacebookShare on Google+Tweet about this on TwitterShare on LinkedIn

1 thought on “fasta format”

Leave a Reply

Your email address will not be published. Required fields are marked *